ROUGE

Gene/Protein Characteristic Table for mKIAA0770

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129210
Description :	Vam6/Vps39-like protein.
Clone Name :	mbh01443 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4306 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2332 bp

Genome contig ID gi66880554r_119730313
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GGAGGCTGCTTCTCAATAAACATAAGTGAAAAACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTTTCCTTGAGCCTCCCTCTTCCCTTTCTGAAGACTAAAGGAAATGTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0770 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0770	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 34..1923, 1974..2768
Length: 894 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL27989	90.2	vacuolar protei...	Mus musculus
BAE24681	97.9	unnamed protein...	Mus musculus
AAL79767	98.1	VPS39 short iso...	Mus musculus
BAC39271	97.7	unnamed protein...	Mus musculus
BAC31205	97.9	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001180 51 319 PF00780 Citron-like

HMMSmart IPR001180 46 325 SM00036 Citron-like

ProfileScan IPR001180 242 297 PS50219 Citron-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001180	51	319	PF00780	Citron-like
HMMSmart	IPR001180	46	325	SM00036	Citron-like
ProfileScan	IPR001180	242	297	PS50219	Citron-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2332 bp
Genome contig ID	gi66880554r_119730313
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GGAGGCTGCTTCTCAATAAACATAAGTGAAAAACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTTTCCTTGAGCCTCCCTCTTCCCTTTCTGAAGACTAAAGGAAATGTA

Gene/Protein Characteristic Table for mKIAA0770

Features of the cloned DNA sequence

Features of the protein sequence