Order Kazusa clone(s) from : ![]() |
Product ID | ORK00631 |
---|---|
Accession No | AB018313 |
Description | vacuolar protein sorting 39 homolog (S. cerevisiae), transcript variant 2 |
Clone name | hk05040s1 |
Vector information | |
cDNA sequence | DNA sequence (4793 bp) Predicted protein sequence (913 aa) |
HaloTag ORF Clone |
FHC00631
![]() |
Flexi ORF Clone | FXC00631 |
Source | Human adult brain |
Rouge ID |
mKIAA0770
by Kazusa Mouse cDNA Project
|
Note | We replaced hk05040, former representative clones for KIAA0770 with hk05040s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2041 bp |
---|---|
Genome contig ID | gi51511731r_40138203 |
PolyA signal sequence (AATAAA,-11) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 40238203 | 40287767 | 25 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TTGACCTGCCATGTGTGCCCT |
---|---|
Primer_r | CATCTCCAGCCTTCTCCATAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |