ROUGE

Gene/Protein Characteristic Table for mKIAA0744

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173017
Description :	Histone deacetylase 9.
Clone Name :	mbg11691 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6440 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4718 bp

Genome contig ID gi65532617r_30557873
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CCTCTAGTCCCATGTGAATAAAAGCTATTTGAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTGTGTCCTAAAGTTTCTACATCCTAGGCACCTGCCATTAAAATGTGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0744 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0744	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 1..1722
Length: 573 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001150976	5.8e-211	89.6	similar to HDAC...	Pan troglodytes
XP_001151044	6e-211	89.6	similar to hist...	Pan troglodytes
XP_518986	6e-211	89.6	similar to hist...	Pan troglodytes
CAD30851	1.1e-210	89.4	histone decetyl...	Homo sapiens
NP_848512	1.1e-210	89.4	histone deacety...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122325	2.5e-116	59.4	mKIAA0600
AK131123	1.4e-71	51.7	mFLJ00062

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000286 286 309 PR01270 Histone deacetylase superfamily

IPR000286 320 335 PR01270 Histone deacetylase superfamily

IPR000286 411 421 PR01270 Histone deacetylase superfamily

HMMPfam IPR000286 139 485 PF00850 Histone deacetylase superfamily

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000286	286	309	PR01270	Histone deacetylase superfamily
IPR000286	320	335	PR01270	Histone deacetylase superfamily
IPR000286	411	421	PR01270	Histone deacetylase superfamily
HMMPfam	IPR000286	139	485	PF00850	Histone deacetylase superfamily

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4718 bp
Genome contig ID	gi65532617r_30557873
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCTCTAGTCCCATGTGAATAAAAGCTATTTGAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTGTGTCCTAAAGTTTCTACATCCTAGGCACCTGCCATTAAAATGTGT

Gene/Protein Characteristic Table for mKIAA0744

Features of the cloned DNA sequence

Features of the protein sequence