ROUGE

Gene/Protein Characteristic Table for mKIAA0741

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173016
Description :	eukaryotic translation initiation factor 5B.
Clone Name :	mfj35162 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4870 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3866 bp

Genome contig ID gi65488608f_38240196
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ACTTGATGCTCAGAAATAAAAGTTTCAGGAACAGT
Flanking genome sequence
(109860 - 109909)
----+----*----+----*----+----*----+----*----+----*
AAAAGTTCAGACCCTCGGCCTTCAAAAAGCTAGTCCCTACCCTATCTTGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0741 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0741	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1004
Length: 333 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC29728	4.2e-132	100.0	unnamed protein...	Mus musculus
AAH99239	4.6e-132	100.0	Eif5b protein [...	Rattus norvegicus
EDL14540	9.8e-132	100.0	mCG126963 [Mus ...	Mus musculus
EDL99216	9.8e-132	100.0	rCG22154, isofo...	Rattus norvegicus
B2GUV7	1.1e-131	100.0	Eukaryotic tran...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000178 1 68 PD186100 Initiation factor 2

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000178	1	68	PD186100	Initiation factor 2

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3866 bp
Genome contig ID	gi65488608f_38240196
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACTTGATGCTCAGAAATAAAAGTTTCAGGAACAGT
Flanking genome sequence (109860 - 109909)	----+--------+--------+--------+--------+----* AAAAGTTCAGACCCTCGGCCTTCAAAAAGCTAGTCCCTACCCTATCTTGA

Gene/Protein Characteristic Table for mKIAA0741

Features of the cloned DNA sequence

Features of the protein sequence