ROUGE

Gene/Protein Characteristic Table for mKIAA0723

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129199
Description :	matrin 3.
Clone Name :	mbh02469 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3804 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 996 bp

Genome contig ID gi65551972f_35685871
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACTGAAGTGAATACCAATAAAAAAAAAAAAAACTT
Flanking genome sequence
(129223 - 129272)
----+----*----+----*----+----*----+----*----+----*
AGGTCATGTTGATTGGTTGGTTAAACATGTTTGGATGTTAACCAAAATAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0723 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0723	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 250..2808
Length: 852 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8K310	100.0	Matrin-3.	Mus musculus
BAE36204	99.9	unnamed protein...	Mus musculus
CAJ18530	99.9	Matr3 [Mus musc...	Mus musculus
EDK97130	99.9	mCG121979, isof...	Mus musculus
BAD90681	99.2	nuclear scaffol...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR003604 294 328 SM00451 Zinc finger

IPR000504 405 475 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 503 573 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

IPR003604 803 838 SM00451 Zinc finger

ProfileScan IPR000504 404 479 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 502 577 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

IPR000690 806 837 PS50171 Zinc finger

ScanRegExp IPR007087 299 321 PS00028 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003604	294	328	SM00451	Zinc finger
IPR000504	405	475	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	503	573	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
IPR003604	803	838	SM00451	Zinc finger
ProfileScan	IPR000504	404	479	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	502	577	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
IPR000690	806	837	PS50171	Zinc finger
ScanRegExp	IPR007087	299	321	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	996 bp
Genome contig ID	gi65551972f_35685871
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACTGAAGTGAATACCAATAAAAAAAAAAAAAACTT
Flanking genome sequence (129223 - 129272)	----+--------+--------+--------+--------+----* AGGTCATGTTGATTGGTTGGTTAAACATGTTTGGATGTTAACCAAAATAT

Gene/Protein Characteristic Table for mKIAA0723

Features of the cloned DNA sequence

Features of the protein sequence