ROUGE

Gene/Protein Characteristic Table for mKIAA0684

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122345
Description :	Ubiquitin conjugation factor E4 B.
Clone Name :	mbg02790 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5014 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1255 bp

Genome contig ID gi65493515r_147720784
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AACACAATCGACAATAAACGGTGATGCCCATTCGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGGAGCCTCCTGTGAGTCGTCTTTTTGTTGAAAGAAATGGGTGGGGAAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0684 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0684	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 199..3759
Length: 1186 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH75620	99.9	Ubiquitination ...	Mus musculus
Q9ES00	99.8	Ubiquitin conju...	Mus musculus
BAC26672	99.7	unnamed protein...	Mus musculus
AAG17287	99.7	ubiquitin fusio...	Mus musculus
AAH67402	99.4	Ubiquitination ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172893	3.3e-19	26.2	mKIAA0126

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003613 1111 1184 PF04564 U box

HMMSmart IPR003613 1115 1177 SM00504 U box

ProfileScan NULL 89 131 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003613	1111	1184	PF04564	U box
HMMSmart	IPR003613	1115	1177	SM00504	U box
ProfileScan	NULL	89	131	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1255 bp
Genome contig ID	gi65493515r_147720784
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AACACAATCGACAATAAACGGTGATGCCCATTCGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGAGCCTCCTGTGAGTCGTCTTTTTGTTGAAAGAAATGGGTGGGGAAG

Gene/Protein Characteristic Table for mKIAA0684

Features of the cloned DNA sequence

Features of the protein sequence