ROUGE |
Gene/Protein Characteristic Table for mKIAA0679 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129188 |
---|---|
meningioma expressed antigen 5. | |
mpm03050 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5024 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1883 bp Genome contig ID gi65553144r_45197698 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
CAGACCATGCAAGAGGCACAATAAAACTTGAAGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATGTGTGCTGTGCTGCTTTTTCTCTGGGTTCTCCCTTTTTTTCCCTCAC
KIAA Alignment based on: KIAA0679 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 28..3141
Length: 1037 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |