ROUGE

Gene/Protein Characteristic Table for mKIAA0678

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093258
Description :
Clone Name :	mbh00428 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3618 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 717 bp

Genome contig ID gi65519420r_104029078
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
TTTAAAAATAAAGGGAATTGACTGCTTTGTTAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGATATGTATGTTCTGTAATTTTAGCCTTTGGAAACTTCTTCCATGTTCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0678 DNA sequence

KIAA	Alignment based on:
KIAA0678	DNA sequence

Features of the protein sequence	Description

Coding region: 1..2901
Length: 966 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL21088	100.0	mCG115602 [Mus ...	Mus musculus
BAE25043	100.0	unnamed protein...	Mus musculus
BAE22711	100.0	unnamed protein...	Mus musculus
BAC86133	95.5	unnamed protein...	Homo sapiens
O75165	95.5	DnaJ homolog su...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001623 24 88 PF00226 Heat shock protein DnaJ

HMMSmart IPR001623 23 81 SM00271 Heat shock protein DnaJ

ProfileScan IPR001623 24 81 PS50076 Heat shock protein DnaJ

ScanRegExp IPR001412 933 944 PS00178 Aminoacyl-tRNA synthetase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001623	24	88	PF00226	Heat shock protein DnaJ
HMMSmart	IPR001623	23	81	SM00271	Heat shock protein DnaJ
ProfileScan	IPR001623	24	81	PS50076	Heat shock protein DnaJ
ScanRegExp	IPR001412	933	944	PS00178	Aminoacyl-tRNA synthetase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 699 719 GELAVGGVFLRIFIAQPAWVL

Method	From	To	amino acid sequence
SOSUI	699	719	GELAVGGVFLRIFIAQPAWVL

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	717 bp
Genome contig ID	gi65519420r_104029078
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TTTAAAAATAAAGGGAATTGACTGCTTTGTTAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATATGTATGTTCTGTAATTTTAGCCTTTGGAAACTTCTTCCATGTTCA

Gene/Protein Characteristic Table for mKIAA0678

Features of the cloned DNA sequence

Features of the protein sequence