ROUGE

Gene/Protein Characteristic Table for mKIAA0670

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122342
Description :	Apoptotic chromatin condensation inducer in the nucleus.
Clone Name :	mbh02512 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4370 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 567 bp

Genome contig ID gi65540054r_49058873
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
TGGAAAAATAAAAATCTGACTTAGTTTTGACTAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTGAGTGCCTTTCCTTGGGAAGAGTTTGGGTGAAAGGGGAAGGTGAAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0670 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0670	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..3803
Length: 1266 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL36333	99.8	apoptotic chrom...	Mus musculus
CAX15407	99.2	apoptotic chrom...	Mus musculus
NP_001078942	99.2	apoptotic chrom...	Mus musculus
AAI40806	86.3	ACIN1 protein [...	Homo sapiens
XP_858297	85.8	similar to Apop...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003034 12 46 PF02037 DNA-binding SAP

HMMSmart IPR003034 12 46 SM00513 DNA-binding SAP

ProfileScan IPR003034 12 46 PS50800 DNA-binding SAP

NULL 82 383 PS50313 NULL

IPR000694 330 411 PS50099 Proline-rich region

NULL 509 607 PS50324 NULL

IPR000694 1041 1058 PS50099 Proline-rich region

NULL 1059 1266 PS50323 NULL

NULL 1061 1232 PS50313 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003034	12	46	PF02037	DNA-binding SAP
HMMSmart	IPR003034	12	46	SM00513	DNA-binding SAP
ProfileScan	IPR003034	12	46	PS50800	DNA-binding SAP
NULL	82	383	PS50313	NULL
IPR000694	330	411	PS50099	Proline-rich region
NULL	509	607	PS50324	NULL
IPR000694	1041	1058	PS50099	Proline-rich region
NULL	1059	1266	PS50323	NULL
NULL	1061	1232	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	567 bp
Genome contig ID	gi65540054r_49058873
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TGGAAAAATAAAAATCTGACTTAGTTTTGACTAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGAGTGCCTTTCCTTGGGAAGAGTTTGGGTGAAAGGGGAAGGTGAAT

Gene/Protein Characteristic Table for mKIAA0670

Features of the cloned DNA sequence

Features of the protein sequence