ROUGE

Gene/Protein Characteristic Table for mKIAA0661

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129184
Description :	ring finger protein 40.
Clone Name :	mpm03031 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4059 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 949 bp

Genome contig ID gi65511124f_121538656
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AATTGTTATGAATAAAATACCCAACCCTAGGCTGC
Flanking genome sequence
(114670 - 114719)
----+----*----+----*----+----*----+----*----+----*
AGAGAAGCCCGTCCATTTGGTCTAACCTGAGTCTCTGCGCTACACCTCAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0661 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0661	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..3110
Length: 1035 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q3U319	100.0	E3 ubiquitin-pr...	Mus musculus
BAE32971	99.9	unnamed protein...	Mus musculus
AAH38348	99.9	Ring finger pro...	Mus musculus
Q8CJB9	98.1	E3 ubiquitin-pr...	Rattus norvegicus
XP_848895	93.5	similar to ring...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220492	1.1e-48	58.4	mKIAA4116

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001841 982 1020 PF00097 Zinc finger

HMMSmart IPR001841 982 1020 SM00184 Zinc finger

ProfileScan IPR001841 982 1021 PS50089 Zinc finger

ScanRegExp IPR001841 997 1006 PS00518 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	982	1020	PF00097	Zinc finger
HMMSmart	IPR001841	982	1020	SM00184	Zinc finger
ProfileScan	IPR001841	982	1021	PS50089	Zinc finger
ScanRegExp	IPR001841	997	1006	PS00518	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	949 bp
Genome contig ID	gi65511124f_121538656
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AATTGTTATGAATAAAATACCCAACCCTAGGCTGC
Flanking genome sequence (114670 - 114719)	----+--------+--------+--------+--------+----* AGAGAAGCCCGTCCATTTGGTCTAACCTGAGTCTCTGCGCTACACCTCAC

Gene/Protein Characteristic Table for mKIAA0661

Features of the cloned DNA sequence

Features of the protein sequence