| ROUGE |
Gene/Protein Characteristic Table for mKIAA0641 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AB093253 |
|---|---|
| apoptosis-associated tyrosine kinase. | |
| mbg11644 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5687 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1084 bp Genome contig ID gi65527427r_119728414 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CTTGTTCCTTGTTTTTTAAGAGAAACCAAGCTAAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAACAGCCTGTGTGCTCAGTGTTTTCTTTTGGGGTCTGTAGCTAAC
KIAA Alignment based on: KIAA0641 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 356..4603
Length: 1415 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |