ROUGE

Gene/Protein Characteristic Table for mKIAA0637

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122335
Description :
Clone Name :	mbg01921 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5343 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1277 bp

Genome contig ID gi65543215f_88703678
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
GATTCTGAAATTAAACTTTTTATTTGCGATTTTCT
Flanking genome sequence
(132769 - 132818)
----+----*----+----*----+----*----+----*----+----*
ATTGCTGACTGATGATGGCTTTTTATTTTTAGGATAAAATGCTTTTTTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0637 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0637	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 547..2172, 2195..4066
Length: 1165 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH52174	99.3	Zinc finger, BE...	Mus musculus
XP_001480230	99.1	similar to Zinc...	Mus musculus
NP_001128272	95.8	zinc finger, BE...	Rattus norvegicus
XP_001111467	82.4	zinc finger, BE...	Macaca mulatta
CAB62924	82.2	zinc finger, BE...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003656 121 169 PF02892 Zinc finger

IPR003656 291 339 PF02892 Zinc finger

IPR003656 463 510 PF02892 Zinc finger

IPR003656 557 605 PF02892 Zinc finger

IPR008906 1078 1158 PF05699 HAT dimerisation

ProfileScan IPR003656 118 175 PS50808 Zinc finger

IPR003656 288 345 PS50808 Zinc finger

IPR003656 460 516 PS50808 Zinc finger

IPR003656 554 611 PS50808 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003656	121	169	PF02892	Zinc finger
IPR003656	291	339	PF02892	Zinc finger
IPR003656	463	510	PF02892	Zinc finger
IPR003656	557	605	PF02892	Zinc finger
IPR008906	1078	1158	PF05699	HAT dimerisation
ProfileScan	IPR003656	118	175	PS50808	Zinc finger
IPR003656	288	345	PS50808	Zinc finger
IPR003656	460	516	PS50808	Zinc finger
IPR003656	554	611	PS50808	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1277 bp
Genome contig ID	gi65543215f_88703678
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- GATTCTGAAATTAAACTTTTTATTTGCGATTTTCT
Flanking genome sequence (132769 - 132818)	----+--------+--------+--------+--------+----* ATTGCTGACTGATGATGGCTTTTTATTTTTAGGATAAAATGCTTTTTTTT

Gene/Protein Characteristic Table for mKIAA0637

Features of the cloned DNA sequence

Features of the protein sequence