ROUGE |
Gene/Protein Characteristic Table for mKIAA0637 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122335 |
---|---|
mbg01921 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5343 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1277 bp Genome contig ID gi65543215f_88703678 PolyA signal sequence
(ATTAAA,-26) +----*----+----*----+----*----+----
GATTCTGAAATTAAACTTTTTATTTGCGATTTTCTFlanking genome sequence
(132769 - 132818) ----+----*----+----*----+----*----+----*----+----*
ATTGCTGACTGATGATGGCTTTTTATTTTTAGGATAAAATGCTTTTTTTT
KIAA Alignment based on: KIAA0637 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 547..2172, 2195..4066
Length: 1165 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003656 | 121 | 169 | PF02892 | Zinc finger |
IPR003656 | 291 | 339 | PF02892 | Zinc finger | |
IPR003656 | 463 | 510 | PF02892 | Zinc finger | |
IPR003656 | 557 | 605 | PF02892 | Zinc finger | |
IPR008906 | 1078 | 1158 | PF05699 | HAT dimerisation | |
ProfileScan | IPR003656 | 118 | 175 | PS50808 | Zinc finger |
IPR003656 | 288 | 345 | PS50808 | Zinc finger | |
IPR003656 | 460 | 516 | PS50808 | Zinc finger | |
IPR003656 | 554 | 611 | PS50808 | Zinc finger |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |