ROUGE

Gene/Protein Characteristic Table for mKIAA0633

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122334
Description :	cordon-bleu protein.
Clone Name :	mbg06737 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5447 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1364 bp

Genome contig ID gi65527427r_12031471
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CTTAGTGCCACAAATAAATGCAAATCCAATGCTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTGTCGTGTGGACTTCATGCTACAGTGTCCATCCTGCCTACAAAATGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0633 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0633	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 79..4083
Length: 1334 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL40652	100.0	cordon-bleu, is...	Mus musculus
Q5NBX1	99.9	Protein cordon-...	Mus musculus
AAI50707	99.8	Cordon-bleu [Mu...	Mus musculus
AAP74341	99.6	cordon-bleu [Mu...	Mus musculus
CAI35985	93.7	cordon-bleu [Mu...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173076	2.4e-13	26.1	mKIAA0977

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003124 1182 1202 PF02205 Actin-binding WH2

IPR003124 1222 1242 PF02205 Actin-binding WH2

IPR003124 1310 1330 PF02205 Actin-binding WH2

HMMSmart IPR003124 1182 1202 SM00246 Actin-binding WH2

IPR003124 1222 1242 SM00246 Actin-binding WH2

IPR003124 1310 1330 SM00246 Actin-binding WH2

ProfileScan IPR000694 358 430 PS50099 Proline-rich region

IPR000694 1274 1290 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003124	1182	1202	PF02205	Actin-binding WH2
IPR003124	1222	1242	PF02205	Actin-binding WH2
IPR003124	1310	1330	PF02205	Actin-binding WH2
HMMSmart	IPR003124	1182	1202	SM00246	Actin-binding WH2
IPR003124	1222	1242	SM00246	Actin-binding WH2
IPR003124	1310	1330	SM00246	Actin-binding WH2
ProfileScan	IPR000694	358	430	PS50099	Proline-rich region
IPR000694	1274	1290	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1364 bp
Genome contig ID	gi65527427r_12031471
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CTTAGTGCCACAAATAAATGCAAATCCAATGCTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGTCGTGTGGACTTCATGCTACAGTGTCCATCCTGCCTACAAAATGG

Gene/Protein Characteristic Table for mKIAA0633

Features of the cloned DNA sequence

Features of the protein sequence