| ROUGE | 
| Gene/Protein Characteristic Table for mKIAA0616 | 
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129173 | 
|---|---|
| mbg10353 [Vector Info] | |
| Source : | Mouse brain | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 5664 bp
|   | 
| cloned DNA seq. | |
| Warning for N-terminal truncation: | YES | 
| Warning for coding interruption: | NO | 
Length of 3'UTR 3759 bp Genome contig ID gi65515060r_69436831 PolyA signal sequence 
(AATAAA,-21)
TTGTAATGAAATGTAATAAAAACCCAATGTTTTCGFlanking genome sequence 
(100000 - 99951)
TCTGGGCCTCTTCCTCTTTTTCCAATCTCCCTCCAGGTTACCTCATCTTC
KIAA Alignment based on: KIAA0616 DNA sequence, AA sequence, Physical map 
| Features of the protein sequence | Description | |
Coding region: 1..1905
Length: 634 aa
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
 
    | How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage   | |