KIAA0616

Product ID	ORK04637
Accession No	AB014516
Description	CREB regulated transcription coactivator 1
Clone name	hg03623
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6718 bp) Predicted protein sequence (634 aa)
Source	Human adult brain
Rouge ID	mKIAA0616 by Kazusa Mouse cDNA Project

Length: 6718 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4812 bp
Genome contig ID	gi42406306f_18555560
PolyA signal sequence (None)	+--------+--------+----*----+---- TACTCTGCCACGGACGTCCCGTGGGCCATGATTGT
Flanking genome sequence (198446 - 198495)	----+--------+--------+--------+--------+----* GGGCGGCCGCAGCGGGCGGGGGCAGGCGGCTCAGGGCACACTCGGCCGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	18655560	18754004	15	100.0	Perfect prediction

Length: 634 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAQ98856	9.2e-152	100.0	transducer of r...	Homo sapiens
XP_001115541	3.5e-145	99.5	mucoepidermoid ...	Macaca mulatta
XP_871861	1.1e-142	93.9	mucoepidermoid ...	Bos taurus
XP_001915289	9.7e-138	93.8	similar to muco...	Equus caballus
Q6UUV9	8.6e-133	97.5	CREB-regulated ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TGGTGCTGGCTCTGATGATTC
Primer_r	AAGTTCTTGATGGCTGGGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 19

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TGGTGCTGGCTCTGATGATTC
Primer_r	AAGTTCTTGATGGCTGGGCTG
PCR product length	174 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles