ROUGE |
Gene/Protein Characteristic Table for mKIAA0612 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122329 |
---|---|
Peripheral-type benzodiazepine receptor-associated protein 1. | |
mbj00855 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2689 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1455 bp Genome contig ID gi65527427f_87406786 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
AAAAGACATTTTACTATAATAAAGTCTATTTTCACFlanking genome sequence
(107129 - 107178) ----+----*----+----*----+----*----+----*----+----*
AAAATTGATGCTGGGCTCTGCCTGGGCAAAAGACTCCTTAGAGGGATGGA
KIAA Alignment based on: KIAA0612 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 173..1234
Length: 353 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |