| ROUGE |
Gene/Protein Characteristic Table for mKIAA0610 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129171 |
|---|---|
| spastic paraplegia 20, spartin (Troyer syndrome) homolog. | |
| mph00843 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3567 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1631 bp Genome contig ID gi65492966f_54646466 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
TTAATGAATGTGCTTTGAGAATAAAATGGTTTTTGFlanking genome sequence
(125184 - 125233) ----+----*----+----*----+----*----+----*----+----*
AATTGCTGGGCCTCAGATGTATTCACTGGACTTATATTTCAGGAATACAG
KIAA Alignment based on: KIAA0610 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1936
Length: 644 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage
| |