ROUGE

Gene/Protein Characteristic Table for mKIAA0607

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122327
Description :	neurochondrin. neurochondrin-1. neurochondrin-2. minisatellite 10ae detected by probe MMS10.
Clone Name :	mbh00762 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3034 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1073 bp

Genome contig ID gi65493515r_125670928
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGCACATGTGGACACTCAATAAATGTTTATTGGTG
Flanking genome sequence
(99948 - 99899)
----+----*----+----*----+----*----+----*----+----*
ATGAGAAGCCTCCTTTGTGGTCTGCCTTGCACCTCCTCTGCCTTAACCTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0607 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0607	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1961
Length: 652 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA75227	100.0	neurochondrin-2...	Mus musculus
Q9Z0E0	100.0	Neurochondrin; ...	Mus musculus
AAH17126	99.8	Neurochondrin [...	Mus musculus
BAE41841	99.8	unnamed protein...	Mus musculus
BAA22938	99.7	NORBIN [Rattus ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008709 1 652 PF05536 Neurochondrin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008709	1	652	PF05536	Neurochondrin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1073 bp
Genome contig ID	gi65493515r_125670928
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGCACATGTGGACACTCAATAAATGTTTATTGGTG
Flanking genome sequence (99948 - 99899)	----+--------+--------+--------+--------+----* ATGAGAAGCCTCCTTTGTGGTCTGCCTTGCACCTCCTCTGCCTTAACCTG

Gene/Protein Characteristic Table for mKIAA0607

Features of the cloned DNA sequence

Features of the protein sequence