ROUGE

Gene/Protein Characteristic Table for mKIAA0596

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122323
Description :	mitogen activated protein kinase binding protein 1. Jun N-terminal kinase-binding protein 1. mitogen activated protein kinase binding proten 1.
Clone Name :	mbg02022 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6222 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3792 bp

Genome contig ID gi66880554f_119429191
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATGTATGAAATTGTCAATAAACACAATCATTTGTT
Flanking genome sequence
(112055 - 112104)
----+----*----+----*----+----*----+----*----+----*
AACCTGCTAGCAAATTCTGAGAAGAGCGCCGCTTGTTGCACCTCCTAGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0596 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0596	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 346..2400, 2661..3500, 3900..4217
Length: 1070 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL27979	98.6	mitogen activat...	Mus musculus
EDL27978	98.6	mitogen activat...	Mus musculus
Q6NS57	97.9	Mitogen-activat...	Mus musculus
CAM22679	97.9	mitogen activat...	Mus musculus
BAA85449	97.1	JNK-binding pro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001680 34 71 PF00400 WD-40 repeat

IPR001680 76 116 PF00400 WD-40 repeat

IPR001680 122 161 PF00400 WD-40 repeat

IPR001680 167 208 PF00400 WD-40 repeat

IPR001680 216 253 PF00400 WD-40 repeat

IPR001680 258 295 PF00400 WD-40 repeat

HMMSmart IPR001680 32 71 SM00320 WD-40 repeat

IPR001680 74 116 SM00320 WD-40 repeat

IPR001680 120 161 SM00320 WD-40 repeat

IPR001680 168 208 SM00320 WD-40 repeat

IPR001680 211 253 SM00320 WD-40 repeat

IPR001680 256 295 SM00320 WD-40 repeat

ProfileScan IPR001680 39 304 PS50294 WD-40 repeat

IPR001680 263 304 PS50082 WD-40 repeat

ScanRegExp IPR002114 426 441 PS00589 HPr serine phosphorylation site

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	34	71	PF00400	WD-40 repeat
IPR001680	76	116	PF00400	WD-40 repeat
IPR001680	122	161	PF00400	WD-40 repeat
IPR001680	167	208	PF00400	WD-40 repeat
IPR001680	216	253	PF00400	WD-40 repeat
IPR001680	258	295	PF00400	WD-40 repeat
HMMSmart	IPR001680	32	71	SM00320	WD-40 repeat
IPR001680	74	116	SM00320	WD-40 repeat
IPR001680	120	161	SM00320	WD-40 repeat
IPR001680	168	208	SM00320	WD-40 repeat
IPR001680	211	253	SM00320	WD-40 repeat
IPR001680	256	295	SM00320	WD-40 repeat
ProfileScan	IPR001680	39	304	PS50294	WD-40 repeat
IPR001680	263	304	PS50082	WD-40 repeat
ScanRegExp	IPR002114	426	441	PS00589	HPr serine phosphorylation site

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3792 bp
Genome contig ID	gi66880554f_119429191
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATGTATGAAATTGTCAATAAACACAATCATTTGTT
Flanking genome sequence (112055 - 112104)	----+--------+--------+--------+--------+----* AACCTGCTAGCAAATTCTGAGAAGAGCGCCGCTTGTTGCACCTCCTAGAG

Gene/Protein Characteristic Table for mKIAA0596

Features of the cloned DNA sequence

Features of the protein sequence