Gene/Protein Characteristic Table for mKIAA0595

Length: 5198 bp

Restriction map

Length of 3'UTR	256 bp
Genome contig ID	gi65553144f_45503752
PolyA signal sequence (AATAAA,-20)	+----*----+----*----+----*----+---- TGGGGGGGGAACTCTAATAAACATGAACTAGAGGG
Flanking genome sequence (116327 - 116376)	----+----*----+----*----+----*----+----*----+----* AACTTCCAGCGTGTCCTTTCTGTGTGCTAATGTCTATCTGGTATTTCTCT

KIAA	Alignment based on:
KIAA0595	DNA sequence, AA sequence, Physical map

Coding region: 2..4942

Length: 1646 aa

Entry Exp ID% Protein Source EDL41975 0 99.7 mCG10300, isofo... Mus musculus Q6NZN1 0 99.3 Peroxisome prol... Mus musculus EDL94331 0 87.6 peroxisome prol... Rattus norvegicus BAE28245 0 99.3 unnamed protein... Mus musculus EDL41976 0 99.2 mCG10300, isofo... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173178 8.9e-05 25.6 mKIAA1471 AK220466 0.0005 26.5 mKIAA4062 AK122287 0.00051 23.3 mKIAA0458

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	1527	1593	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
HMMSmart	IPR000504	1526	1597	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
ProfileScan	IPR000694	751	1069	PS50099	Proline-rich region
	NULL	1389	1525	PS50323	NULL
	NULL	1397	1502	PS50324	NULL
	IPR000504	1525	1601	PS50102	RNA-binding region RNP-1 (RNA recognition motif)

Method	From	To	amino acid sequence
-	-	-	-