ROUGE |
Gene/Protein Characteristic Table for mKIAA0595 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122322 |
---|---|
mbg04268 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5198 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 256 bp Genome contig ID gi65553144f_45503752 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TGGGGGGGGAACTCTAATAAACATGAACTAGAGGGFlanking genome sequence
(116327 - 116376) ----+----*----+----*----+----*----+----*----+----*
AACTTCCAGCGTGTCCTTTCTGTGTGCTAATGTCTATCTGGTATTTCTCT
KIAA Alignment based on: KIAA0595 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..4942
Length: 1646 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000504 | 1527 | 1593 | PF00076 | RNA-binding region RNP-1 (RNA recognition motif) |
HMMSmart | IPR000504 | 1526 | 1597 | SM00360 | RNA-binding region RNP-1 (RNA recognition motif) |
ProfileScan | IPR000694 | 751 | 1069 | PS50099 | Proline-rich region |
NULL | 1389 | 1525 | PS50323 | NULL | |
NULL | 1397 | 1502 | PS50324 | NULL | |
IPR000504 | 1525 | 1601 | PS50102 | RNA-binding region RNP-1 (RNA recognition motif) |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |