ROUGE

Gene/Protein Characteristic Table for mKIAA0458

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122287
Description :
Clone Name :	mbg00904 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5137 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3428 bp

Genome contig ID gi65493515f_149006838
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TATTTGTGGACATAAATAAAACCAAGCTACACTAC
Flanking genome sequence
(107489 - 107538)
----+----*----+----*----+----*----+----*----+----*
AGCACCCTGTGTGTTGGCCAGTGCACTGTCTCATTCTGGAGTGTGGGTGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0458 DNA sequence

KIAA	Alignment based on:
KIAA0458	DNA sequence

Features of the protein sequence	Description

Coding region: 3..1694, 1708..2664
Length: 882 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q80TZ9	3e-202	99.5	Arginine-glutam...	Mus musculus
CAM22172	4.9e-202	99.4	arginine glutam...	Mus musculus
CAM16595	5.5e-202	99.4	arginine glutam...	Mus musculus
EDL14889	1.2e-201	99.3	mCG130721 [Mus ...	Mus musculus
AAA98970	1e-198	98.0	atrophin-1 rela...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173178	2.2e-05	31.8	mKIAA1471

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002951 1 882 PF03154 Atrophin

ProfileScan IPR000694 66 438 PS50099 Proline-rich region

NULL 484 523 PS50313 NULL

NULL 741 761 PS50316 NULL

IPR000694 767 826 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002951	1	882	PF03154	Atrophin
ProfileScan	IPR000694	66	438	PS50099	Proline-rich region
NULL	484	523	PS50313	NULL
NULL	741	761	PS50316	NULL
IPR000694	767	826	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3428 bp
Genome contig ID	gi65493515f_149006838
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATTTGTGGACATAAATAAAACCAAGCTACACTAC
Flanking genome sequence (107489 - 107538)	----+--------+--------+--------+--------+----* AGCACCCTGTGTGTTGGCCAGTGCACTGTCTCATTCTGGAGTGTGGGTGG

Gene/Protein Characteristic Table for mKIAA0458

Features of the cloned DNA sequence

Features of the protein sequence