ROUGE |
Gene/Protein Characteristic Table for mKIAA0592 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122320 |
---|---|
mbg02410 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5227 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2504 bp Genome contig ID gi65504368f_116545642 PolyA signal sequence
(AATAAA,-12) +----*----+----*----+----*----+----
TATGCTTAAAATTACAAATAAAAAATAAACGCTTCFlanking genome sequence
(154562 - 154611) ----+----*----+----*----+----*----+----*----+----*
ACAGAGGTTTGTTCTTACTTAATAAGAGTGCATGGAAGCTCATGCTAACA
KIAA Alignment based on: KIAA0592 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 102..2699, 3887..5035
Length: 1248 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |