|
Order Kazusa clone(s) from : |
| Product ID | ORK00570 |
|---|---|
| Accession No | AB011164 |
| Description | family with sequence similarity 21, member C, transcript variant 1 |
| Clone name | hj02807 |
| Vector information | |
| cDNA sequence | DNA sequence (4623 bp) Predicted protein sequence (1353 aa) |
|
HaloTag ORF Clone |
FHC00570
|
| Flexi ORF Clone | FXC00570 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0592
by Kazusa Mouse cDNA Project
|
Length: 4623 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 1353 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
RT-PCR
|
|---|
Experimental conditions| Primer_f | GAAGCAATTAAACCCTCTCAG |
|---|---|
| Primer_r | GATACCAGAGGAGAAGATGTC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 10
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GAAGCAATTAAACCCTCTCAG |
| Primer_r | GATACCAGAGGAGAAGATGTC |
| PCR product length | 183 (1.6k) bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |