ROUGE

Gene/Protein Characteristic Table for mKIAA0586

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172976
Description :
Clone Name :	mth02327 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 5143 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 202 bp

Genome contig ID gi65532617f_67872213
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTTAGTAAGGCTTTTAAATAAAGTAGATATAACTC
Flanking genome sequence
(207869 - 207918)
----+----*----+----*----+----*----+----*----+----*
AACTAAGTCTGGCTGTTTCTTAGAAGCTTGGGGTAACAGGGAACAGTGAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0586 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0586	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 629..2077, 2081..2407, 2521..4791
Length: 1349 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL36552	0	95.3	mCG5765, isofor...	Mus musculus
AAI50745	0	95.1	RIKEN cDNA 2700...	Mus musculus
EDL36553	0	92.5	mCG5765, isofor...	Mus musculus
BAB28215	1.3e-186	100.0	unnamed protein...	Mus musculus
BAC30641	7.8e-178	99.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	202 bp
Genome contig ID	gi65532617f_67872213
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTAGTAAGGCTTTTAAATAAAGTAGATATAACTC
Flanking genome sequence (207869 - 207918)	----+--------+--------+--------+--------+----* AACTAAGTCTGGCTGTTTCTTAGAAGCTTGGGGTAACAGGGAACAGTGAA

Gene/Protein Characteristic Table for mKIAA0586

Features of the cloned DNA sequence

Features of the protein sequence