ROUGE

Gene/Protein Characteristic Table for mKIAA0585

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122317
Description :	phosphatidylserine receptor.
Clone Name :	mbg05621 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4529 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3535 bp

Genome contig ID gi65527427r_116558527
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACCCTTTACCTATTTAATAAAAACGGATACATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATACTGTGGACAGCTTTCTTTGGGGCATACCATAGTCTCCCTAAGCTCCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0585 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0585	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..994
Length: 330 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL34596	1.1e-117	100.0	phosphatidylser...	Mus musculus
ABU68574	1.2e-117	100.0	phosphatidylser...	Mus musculus
Q9ERI5	1.4e-117	100.0	Histone arginin...	Mus musculus
EDL34599	1.5e-117	100.0	phosphatidylser...	Mus musculus
EDM06698	2.7e-117	99.6	rCG35128, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003347 206 311 PF02373 Transcription factor jumonji

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003347	206	311	PF02373	Transcription factor jumonji

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3535 bp
Genome contig ID	gi65527427r_116558527
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACCCTTTACCTATTTAATAAAAACGGATACATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATACTGTGGACAGCTTTCTTTGGGGCATACCATAGTCTCCCTAAGCTCCT

Gene/Protein Characteristic Table for mKIAA0585

Features of the cloned DNA sequence

Features of the protein sequence