Gene/Protein Characteristic Table for mKIAA0579

Length: 5544 bp

Restriction map

Length of 3'UTR	4840 bp
Genome contig ID	gi65515060r_120880700
PolyA signal sequence (AATAAA,-10)	+----*----+----*----+----*----+---- TTATGAGTAAATTTAATGTACGGAAAATAAAAATT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AAAAAAAAAACTCAACATGTTCACCATTCTCAGATTTTTTGGGGGGGCGG

KIAA	Alignment based on:
KIAA0579	DNA sequence, AA sequence, Physical map

Coding region: 3..704

Length: 233 aa

Entry Exp ID% Protein Source Q8VIG0 6.2e-60 100.0 Zinc finger CCH... Mus musculus AAH09020 7.1e-60 100.0 Zcchc14 protein... Mus musculus EDL92728 1.2e-57 95.3 zinc finger, CC... Rattus norvegicus XP_344781 2e-57 95.3 similar to BDG-... Rattus norvegicus XP_001079169 2e-57 95.3 similar to BDG-... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173248 6.3e-17 39.5 mKIAA1744

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001878	124	133	PR00939	Zinc finger
	IPR001878	133	141	PR00939	Zinc finger
HMMPfam	IPR001878	124	141	PF00098	Zinc finger
HMMSmart	IPR001878	125	141	SM00343	Zinc finger
ProfileScan	IPR001878	126	141	PS50158	Zinc finger
	NULL	176	199	PS50314	NULL

Method	From	To	amino acid sequence
SOSUI	180	202	FKMIFIHTVFFFFFFKIYLFIII