Gene/Protein Characteristic Table for mKIAA0573

Length: 5210 bp

Restriction map

Length of 3'UTR	3898 bp
Genome contig ID	gi65493515r_48006635
PolyA signal sequence (AATAAA,-22)	+----*----+----*----+----*----+---- TGTATTTCCAAGTAATAAAATTATATTTGCAAAAT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ATTTTATATTTGAGCATTTTTACTAATTGCATAAATACTGTTTTATGACT

KIAA	Alignment based on:
KIAA0573	DNA sequence, AA sequence, Physical map

Coding region: 2..1312

Length: 436 aa

Entry Exp ID% Protein Source EDL02341 9.6e-176 98.6 thioredoxin dom... Mus musculus Q9D1Q6 1.3e-163 100.0 Thioredoxin dom... Mus musculus BAE24664 1.2e-161 99.3 unnamed protein... Mus musculus AAO17785 9.1e-161 97.8 BWK4 [Rattus no... Rattus norvegicus Q9BS26 9.8e-155 93.1 Thioredoxin dom... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129451 0.00025 19.6 mKIAA1830

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006662	79	87	PR00421	Thioredoxin-related
	IPR006662	87	96	PR00421	Thioredoxin-related
	IPR006662	133	144	PR00421	Thioredoxin-related
HMMPfam	IPR006662	60	171	PF00085	Thioredoxin-related
ProfileScan	IPR006663	60	168	PS50223	Thioredoxin domain 2
ScanRegExp	IPR000886	433	436	PS00014	Endoplasmic reticulum targeting sequence

Method	From	To	amino acid sequence
-	-	-	-