ROUGE

Gene/Protein Characteristic Table for mKIAA0570

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129165
Description :	U2af1-rs1 region 2 (Fragment).
Clone Name :	mpm08072 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4221 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 554 bp

Genome contig ID gi65527427f_23239138
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
CTGTGGAGGAAATAAAGCACACTTGATGTAAAAAT
Flanking genome sequence
(145397 - 145446)
----+----*----+----*----+----*----+----*----+----*
AATGGTTTTATTTTTATTGACATGACTGCTGTTCTGTGTACTTATAAACT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0570 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0570	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3667
Length: 1221 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6ZQ93	93.6	Ubiquitin carbo...	Mus musculus
CAM17340	93.6	ubiquitin speci...	Mus musculus
BAG54261	91.8	unnamed protein...	Homo sapiens
CAE51938	92.0	ubiquitin-speci...	Homo sapiens
EDL07883	93.5	mCG140384 [Mus ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	554 bp
Genome contig ID	gi65527427f_23239138
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CTGTGGAGGAAATAAAGCACACTTGATGTAAAAAT
Flanking genome sequence (145397 - 145446)	----+--------+--------+--------+--------+----* AATGGTTTTATTTTTATTGACATGACTGCTGTTCTGTGTACTTATAAACT

Gene/Protein Characteristic Table for mKIAA0570

Features of the cloned DNA sequence

Features of the protein sequence