ROUGE

Gene/Protein Characteristic Table for mKIAA0564

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129164
Description :
Clone Name :	mpm09246 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4845 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1102 bp

Genome contig ID gi65540054f_73263243
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAAAGCAGTCGCTTCCCAGTATGGTGTCACCACCC
Flanking genome sequence
(293115 - 293164)
----+----*----+----*----+----*----+----*----+----*
AATGAGTATGTGTGTGTGGTTTGTATTTCTAGTCACCTGCTTGTTCCAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0564 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0564	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..3743
Length: 1246 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_920456	99.8	hypothetical pr...	Mus musculus
XP_214237	94.4	similar to F11C...	Rattus norvegicus
CAI39586	84.8	novel protein [...	Homo sapiens
XP_001091849	84.7	similar to F11C...	Macaca mulatta
XP_848634	83.5	similar to F11C...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011704 116 271 PF07728 ATPase associated with various cellular activities

HMMSmart IPR002035 1053 1242 SM00327 von Willebrand factor

ProfileScan IPR002035 1055 1237 PS50234 von Willebrand factor

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011704	116	271	PF07728	ATPase associated with various cellular activities
HMMSmart	IPR002035	1053	1242	SM00327	von Willebrand factor
ProfileScan	IPR002035	1055	1237	PS50234	von Willebrand factor

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1102 bp
Genome contig ID	gi65540054f_73263243
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAAGCAGTCGCTTCCCAGTATGGTGTCACCACCC
Flanking genome sequence (293115 - 293164)	----+--------+--------+--------+--------+----* AATGAGTATGTGTGTGTGGTTTGTATTTCTAGTCACCTGCTTGTTCCAGG

Gene/Protein Characteristic Table for mKIAA0564

Features of the cloned DNA sequence

Features of the protein sequence