ROUGE

Gene/Protein Characteristic Table for mKIAA0560

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122310
Description :	aquarius.
Clone Name :	mbg02505 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4871 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 264 bp

Genome contig ID gi66880554r_113515016
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
CTGAGGTAATCCCTGCATTAAAATCATTTTCTATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACATGTAAGGCATACTTGCCCTTTTTTCTTTTCGGGGTTTCATGTAGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0560 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0560	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 105..4607
Length: 1500 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8CFQ3	100.0	Intron-binding ...	Mus musculus
AAH42479	99.9	Aquarius [Mus m...	Mus musculus
AAI33728	97.8	Aqr protein [Ra...	Rattus norvegicus
EDL27868	99.2	aquarius, isofo...	Mus musculus
XP_510286	94.4	aquarius [Pan t...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129051	0.00024	27.9	mKIAA0083

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	264 bp
Genome contig ID	gi66880554r_113515016
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- CTGAGGTAATCCCTGCATTAAAATCATTTTCTATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACATGTAAGGCATACTTGCCCTTTTTTCTTTTCGGGGTTTCATGTAGC

Gene/Protein Characteristic Table for mKIAA0560

Features of the cloned DNA sequence

Features of the protein sequence