ROUGE

Gene/Protein Characteristic Table for mKIAA0554

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122308
Description :	formin binding protein 1. formin binding protein 17.
Clone Name :	mbg09350 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4726 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2669 bp

Genome contig ID gi66880554r_30858370
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CCTTTCAATGTTAAATAAAGTATAACTTCTAGTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCTGGTTCTCTGTTGTATGAAGAAATGACGCTGGGCCTGGGGAGATGGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0554 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0554	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2057
Length: 684 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q80TY0	2e-200	100.0	Formin-binding ...	Mus musculus
CAM18437	6.8e-198	99.0	formin binding ...	Mus musculus
Q8R511	3.1e-197	98.2	Formin-binding ...	Rattus norvegicus
BAB90845	5e-197	98.1	rapostlin [Ratt...	Rattus norvegicus
BAD13424	1e-194	97.2	rapostlinLd [Ra...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 621 674 PD000066 SH3

FPrintScan IPR001452 620 630 PR00452 SH3

IPR001452 634 649 PR00452 SH3

IPR001452 664 676 PR00452 SH3

HMMPfam IPR001060 69 162 PF00611 Cdc15/Fes/CIP4

IPR001452 620 676 PF00018 SH3

IPR011511 621 676 PF07653 Variant SH3

HMMSmart IPR001060 69 162 SM00055 Cdc15/Fes/CIP4

IPR001452 620 677 SM00326 SH3

ProfileScan IPR001060 69 133 PS50133 Cdc15/Fes/CIP4

IPR000694 404 433 PS50099 Proline-rich region

IPR001452 617 678 PS50002 SH3

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	621	674	PD000066	SH3
FPrintScan	IPR001452	620	630	PR00452	SH3
IPR001452	634	649	PR00452	SH3
IPR001452	664	676	PR00452	SH3
HMMPfam	IPR001060	69	162	PF00611	Cdc15/Fes/CIP4
IPR001452	620	676	PF00018	SH3
IPR011511	621	676	PF07653	Variant SH3
HMMSmart	IPR001060	69	162	SM00055	Cdc15/Fes/CIP4
IPR001452	620	677	SM00326	SH3
ProfileScan	IPR001060	69	133	PS50133	Cdc15/Fes/CIP4
IPR000694	404	433	PS50099	Proline-rich region
IPR001452	617	678	PS50002	SH3

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2669 bp
Genome contig ID	gi66880554r_30858370
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CCTTTCAATGTTAAATAAAGTATAACTTCTAGTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTGGTTCTCTGTTGTATGAAGAAATGACGCTGGGCCTGGGGAGATGGC

Gene/Protein Characteristic Table for mKIAA0554

Features of the cloned DNA sequence

Features of the protein sequence