ROUGE

Gene/Protein Characteristic Table for mKIAA0549

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122305
Description :	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 homolog.
Clone Name :	mbg09571 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4627 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3052 bp

Genome contig ID gi65488608r_59105322
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TAAATCAGTTAATAAACATGAGGCTTCTTAAATTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCCTGTGTCTCCTTGTGATTTTTGTTTCAACCCTACACAATCCAGCAGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0549 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0549	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1575
Length: 524 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL00103	1.2e-186	99.6	trafficking pro...	Mus musculus
AAH60681	1.2e-186	99.6	Trafficking pro...	Mus musculus
BAC29517	1.4e-186	99.4	unnamed protein...	Mus musculus
EDL98975	1.1e-172	93.5	trafficking pro...	Rattus norvegicus
Q8R2H7	1.1e-172	93.5	Trafficking kin...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122426	6.7e-15	44.3	mKIAA1042

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3052 bp
Genome contig ID	gi65488608r_59105322
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TAAATCAGTTAATAAACATGAGGCTTCTTAAATTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCTGTGTCTCCTTGTGATTTTTGTTTCAACCCTACACAATCCAGCAGAG

Gene/Protein Characteristic Table for mKIAA0549

Features of the cloned DNA sequence

Features of the protein sequence