ROUGE

Gene/Protein Characteristic Table for mKIAA0476

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122294
Description :
Clone Name :	mbg03637 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4878 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3302 bp

Genome contig ID gi65492966f_89982162
PolyA signal sequence
(AGTAAA,-27)
+----*----+----*----+----*----+----
GTAAATATAGTAAAAGCTGCTTCTGTCTTTTTTTT
Flanking genome sequence
(108924 - 108973)
----+----*----+----*----+----*----+----*----+----*
CTTCTGCCTCCTGTTCTCTGGATTTGGGGTGACACCTTACTTTTCCTGGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0476 DNA sequence

KIAA	Alignment based on:
KIAA0476	DNA sequence

Features of the protein sequence	Description

Coding region: 470..1468, 1958..3019, 3641..4135
Length: 851 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH40460	98.7	Dennd4b protein...	Mus musculus
AAH49972	98.7	Dennd4b protein...	Mus musculus
AAI51195	98.7	Dennd4b protein...	Mus musculus
EDL15149	98.7	DENN/MADD domai...	Mus musculus
Q3U1Y4	98.7	DENN domain-con...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220476	3.9e-09	54.3	mKIAA4082

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002885 169 203 PF01535 Pentatricopeptide repeat

HMMTigr IPR002885 169 203 TIGR00756 Pentatricopeptide repeat

ProfileScan NULL 241 276 PS50322 NULL

NULL 459 511 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002885	169	203	PF01535	Pentatricopeptide repeat
HMMTigr	IPR002885	169	203	TIGR00756	Pentatricopeptide repeat
ProfileScan	NULL	241	276	PS50322	NULL
NULL	459	511	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3302 bp
Genome contig ID	gi65492966f_89982162
PolyA signal sequence (AGTAAA,-27)	+--------+--------+----*----+---- GTAAATATAGTAAAAGCTGCTTCTGTCTTTTTTTT
Flanking genome sequence (108924 - 108973)	----+--------+--------+--------+--------+----* CTTCTGCCTCCTGTTCTCTGGATTTGGGGTGACACCTTACTTTTCCTGGC

Gene/Protein Characteristic Table for mKIAA0476

Features of the cloned DNA sequence

Features of the protein sequence