ROUGE

Gene/Protein Characteristic Table for mKIAA0465

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122291
Description :	Microtubule-actin crosslinking factor 1.
Clone Name :	mbg10008 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5630 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1172 bp

Genome contig ID gi65493515r_122276831
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
AGACACACTTTTGTATTAAAATTGCTTGCAGTAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGTTTTGTAATTCTTGGCTTTATTCTGAACCACTACTTTATATTTAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0465 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0465	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 1..4458
Length: 1485 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL30377	100.0	mCG1040588, iso...	Mus musculus
EDL30378	100.0	mCG1040588, iso...	Mus musculus
CAM20967	100.0	microtubule-act...	Mus musculus
CAM20969	99.7	microtubule-act...	Mus musculus
CAM20970	99.7	microtubule-act...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129201	1.1e-23	23.0	mKIAA0728
AB093279	2.4e-10	18.3	mKIAA1011
AK220456	3.3e-05	19.2	mKIAA4049
AK220378	0.00047	20.5	mKIAA1251

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002048 1141 1195 PD000012 Calcium-binding EF-hand

HMMPfam IPR002017 95 201 PF00435 Spectrin repeat

IPR002017 204 311 PF00435 Spectrin repeat

IPR002017 314 420 PF00435 Spectrin repeat

IPR002017 423 530 PF00435 Spectrin repeat

IPR002017 533 639 PF00435 Spectrin repeat

IPR002017 642 749 PF00435 Spectrin repeat

IPR002017 750 857 PF00435 Spectrin repeat

IPR002017 860 966 PF00435 Spectrin repeat

IPR002017 969 1103 PF00435 Spectrin repeat

IPR002048 1136 1164 PF00036 Calcium-binding EF-hand

IPR002048 1172 1200 PF00036 Calcium-binding EF-hand

IPR003108 1211 1289 PF02187 Growth-arrest-specific protein 2

HMMSmart IPR002017 98 200 SM00150 Spectrin repeat

IPR002017 207 310 SM00150 Spectrin repeat

IPR002017 317 419 SM00150 Spectrin repeat

IPR002017 426 529 SM00150 Spectrin repeat

IPR002017 536 638 SM00150 Spectrin repeat

IPR002017 645 748 SM00150 Spectrin repeat

IPR002017 755 856 SM00150 Spectrin repeat

IPR002017 863 965 SM00150 Spectrin repeat

IPR002017 972 1102 SM00150 Spectrin repeat

IPR002048 1136 1164 SM00054 Calcium-binding EF-hand

IPR002048 1172 1200 SM00054 Calcium-binding EF-hand

IPR003108 1211 1289 SM00243 Growth-arrest-specific protein 2

ProfileScan IPR002017 65 151 PS50083 Spectrin repeat

IPR002017 174 274 PS50083 Spectrin repeat

IPR002017 284 384 PS50083 Spectrin repeat

IPR002017 393 491 PS50083 Spectrin repeat

IPR002017 510 600 PS50083 Spectrin repeat

IPR002017 612 712 PS50083 Spectrin repeat

IPR002017 722 821 PS50083 Spectrin repeat

IPR002017 830 928 PS50083 Spectrin repeat

IPR002017 946 1034 PS50083 Spectrin repeat

IPR002017 1079 1137 PS50083 Spectrin repeat

IPR002048 1135 1197 PS50222 Calcium-binding EF-hand

NULL 1319 1456 PS50324 NULL

ScanRegExp IPR002048 1145 1157 PS00018 Calcium-binding EF-hand

IPR002048 1181 1193 PS00018 Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	1141	1195	PD000012	Calcium-binding EF-hand
HMMPfam	IPR002017	95	201	PF00435	Spectrin repeat
IPR002017	204	311	PF00435	Spectrin repeat
IPR002017	314	420	PF00435	Spectrin repeat
IPR002017	423	530	PF00435	Spectrin repeat
IPR002017	533	639	PF00435	Spectrin repeat
IPR002017	642	749	PF00435	Spectrin repeat
IPR002017	750	857	PF00435	Spectrin repeat
IPR002017	860	966	PF00435	Spectrin repeat
IPR002017	969	1103	PF00435	Spectrin repeat
IPR002048	1136	1164	PF00036	Calcium-binding EF-hand
IPR002048	1172	1200	PF00036	Calcium-binding EF-hand
IPR003108	1211	1289	PF02187	Growth-arrest-specific protein 2
HMMSmart	IPR002017	98	200	SM00150	Spectrin repeat
IPR002017	207	310	SM00150	Spectrin repeat
IPR002017	317	419	SM00150	Spectrin repeat
IPR002017	426	529	SM00150	Spectrin repeat
IPR002017	536	638	SM00150	Spectrin repeat
IPR002017	645	748	SM00150	Spectrin repeat
IPR002017	755	856	SM00150	Spectrin repeat
IPR002017	863	965	SM00150	Spectrin repeat
IPR002017	972	1102	SM00150	Spectrin repeat
IPR002048	1136	1164	SM00054	Calcium-binding EF-hand
IPR002048	1172	1200	SM00054	Calcium-binding EF-hand
IPR003108	1211	1289	SM00243	Growth-arrest-specific protein 2
ProfileScan	IPR002017	65	151	PS50083	Spectrin repeat
IPR002017	174	274	PS50083	Spectrin repeat
IPR002017	284	384	PS50083	Spectrin repeat
IPR002017	393	491	PS50083	Spectrin repeat
IPR002017	510	600	PS50083	Spectrin repeat
IPR002017	612	712	PS50083	Spectrin repeat
IPR002017	722	821	PS50083	Spectrin repeat
IPR002017	830	928	PS50083	Spectrin repeat
IPR002017	946	1034	PS50083	Spectrin repeat
IPR002017	1079	1137	PS50083	Spectrin repeat
IPR002048	1135	1197	PS50222	Calcium-binding EF-hand
NULL	1319	1456	PS50324	NULL
ScanRegExp	IPR002048	1145	1157	PS00018	Calcium-binding EF-hand
IPR002048	1181	1193	PS00018	Calcium-binding EF-hand

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1172 bp
Genome contig ID	gi65493515r_122276831
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- AGACACACTTTTGTATTAAAATTGCTTGCAGTAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTTTTGTAATTCTTGGCTTTATTCTGAACCACTACTTTATATTTAAA

Gene/Protein Characteristic Table for mKIAA0465

Features of the cloned DNA sequence

Features of the protein sequence