ROUGE

Gene/Protein Characteristic Table for mKIAA0432

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172950
Description :	cell division cycle 5-like.
Clone Name :	mid08083 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2817 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 316 bp

Genome contig ID gi65550231r_42803186
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TAAACCCTTGAATAAAAAGAACATGTGAAAAATTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTGTAGCCTTTTGTTTGAAGTAATTAGATACTTAGGGTGCCCACAAACC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0432 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0432	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2501
Length: 832 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6A068	100.0	Cell division c...	Mus musculus
O08837	99.6	Cell division c...	Rattus norvegicus
XP_532156	97.3	similar to CDC5...	Canis lupus fam...
XP_001100220	98.0	similar to CDC5...	Macaca mulatta
Q99459	98.0	Cell division c...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001005 38 84 PF00249 Myb

IPR001005 90 134 PF00249 Myb

HMMSmart NULL 37 86 SM00395 NULL

NULL 89 136 SM00395 NULL

ProfileScan IPR001005 33 84 PS50090 Myb

IPR001005 85 134 PS50090 Myb

IPR001472 218 235 PS50079 Bipartite nuclear localization signal

ScanRegExp IPR001005 93 101 PS00037 Myb

IPR001005 112 134 PS00334 Myb

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001005	38	84	PF00249	Myb
IPR001005	90	134	PF00249	Myb
HMMSmart	NULL	37	86	SM00395	NULL
NULL	89	136	SM00395	NULL
ProfileScan	IPR001005	33	84	PS50090	Myb
IPR001005	85	134	PS50090	Myb
IPR001472	218	235	PS50079	Bipartite nuclear localization signal
ScanRegExp	IPR001005	93	101	PS00037	Myb
IPR001005	112	134	PS00334	Myb

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	316 bp
Genome contig ID	gi65550231r_42803186
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TAAACCCTTGAATAAAAAGAACATGTGAAAAATTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGTAGCCTTTTGTTTGAAGTAATTAGATACTTAGGGTGCCCACAAACC

Gene/Protein Characteristic Table for mKIAA0432

Features of the cloned DNA sequence

Features of the protein sequence