|
Order Kazusa clone(s) from : |
| Product ID | ORK04510 |
|---|---|
| Accession No | AB007892 |
| Description | cell division cycle 5-like |
| Clone name | hh01859s1 |
| Vector information | |
| cDNA sequence | DNA sequence (6201 bp) Predicted protein sequence (827 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0432
by Kazusa Mouse cDNA Project
|
| Note | We replaced hh01859, former representative clones for KIAA0432 with hh01859s1. (2002/5/10) |
Length: 6201 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 3710 bp |
|---|---|
| Genome contig ID | gi89161210f_44363457 |
| PolyA signal sequence (ATTAAA,-23) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (162684 - 162733) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 6 | f | 44463457 | 44526139 | 16 | 99.3 | Perfect prediction |
Length: 827 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR014778 | 33 | 79 | PF00249 | Myb |
| IPR014778 | 85 | 129 | PF00249 | Myb | |
| HMMSmart | IPR001005 | 32 | 81 | SM00717 | SANT |
| IPR001005 | 84 | 131 | SM00717 | SANT | |
| ProfileScan | IPR001005 | 28 | 79 | PS50090 | SANT |
| IPR001005 | 80 | 129 | PS50090 | SANT | |
| ScanRegExp | IPR001005 | 88 | 96 | PS00037 | SANT |
| IPR001005 | 107 | 129 | PS00334 | SANT |
RT-PCR
|
|---|
Experimental conditions| Primer_f | GATAAAGCTGCCCAAAGAGAC |
|---|---|
| Primer_r | CATCTCAAGTTCATCCTCATC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 18
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GTGACTGCAGACTTAATGTTG |
| Primer_r | CAATAGCCCAAAAGACCAATC |
| PCR product length | 127 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |