Order Kazusa clone(s) from : ![]() |
Product ID | ORK04510 |
---|---|
Accession No | AB007892 |
Description | cell division cycle 5-like |
Clone name | hh01859s1 |
Vector information | |
cDNA sequence | DNA sequence (6201 bp) Predicted protein sequence (827 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0432
by Kazusa Mouse cDNA Project
|
Note | We replaced hh01859, former representative clones for KIAA0432 with hh01859s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3710 bp |
---|---|
Genome contig ID | gi89161210f_44363457 |
PolyA signal sequence (ATTAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (162684 - 162733) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 44463457 | 44526139 | 16 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR014778 | 33 | 79 | PF00249 | Myb |
IPR014778 | 85 | 129 | PF00249 | Myb | |
HMMSmart | IPR001005 | 32 | 81 | SM00717 | SANT |
IPR001005 | 84 | 131 | SM00717 | SANT | |
ProfileScan | IPR001005 | 28 | 79 | PS50090 | SANT |
IPR001005 | 80 | 129 | PS50090 | SANT | |
ScanRegExp | IPR001005 | 88 | 96 | PS00037 | SANT |
IPR001005 | 107 | 129 | PS00334 | SANT |
![]() |
---|
Primer_f | GATAAAGCTGCCCAAAGAGAC |
---|---|
Primer_r | CATCTCAAGTTCATCCTCATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTGACTGCAGACTTAATGTTG |
Primer_r | CAATAGCCCAAAAGACCAATC |
PCR product length | 127 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |