ROUGE

Gene/Protein Characteristic Table for mKIAA0430

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220341
Description :	LIMKAIN B1 homolog.
Clone Name :	mbg10379 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4795 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 673 bp

Genome contig ID gi65546577r_12776973
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGAAGCTACACGGTGAGACCCTGTCTCAAAAAATT
Flanking genome sequence
(99857 - 99808)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAAAAAAATTACTGTAGAAAGGAAATGTATAATTTCTCGTGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0430 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0430	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 1350..2159, 2846..3196, 3199..4122
Length: 694 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8BJ34	1.3e-134	91.1	Limkain-b1.	Mus musculus
EAW53921	4.8e-120	73.1	limkain b1, iso...	Homo sapiens
Q9Y4F3	5.1e-120	78.1	Limkain-b1.	Homo sapiens
EAW53922	5.5e-120	73.1	limkain b1, iso...	Homo sapiens
EAW53920	5.8e-120	78.0	limkain b1, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007491 329 433 PF04396 Protein of unknown function DUF537

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007491	329	433	PF04396	Protein of unknown function DUF537

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	673 bp
Genome contig ID	gi65546577r_12776973
PolyA signal sequence (None)	+--------+--------+----*----+---- AGAAGCTACACGGTGAGACCCTGTCTCAAAAAATT
Flanking genome sequence (99857 - 99808)	----+--------+--------+--------+--------+----* AAAAAAGAAAAAAAAATTACTGTAGAAAGGAAATGTATAATTTCTCGTGT

Gene/Protein Characteristic Table for mKIAA0430

Features of the cloned DNA sequence

Features of the protein sequence