ROUGE |
Gene/Protein Characteristic Table for mKIAA0430 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220341 |
---|---|
LIMKAIN B1 homolog. | |
mbg10379 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4795 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 673 bp Genome contig ID gi65546577r_12776973 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AGAAGCTACACGGTGAGACCCTGTCTCAAAAAATTFlanking genome sequence
(99857 - 99808) ----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAAAAAAATTACTGTAGAAAGGAAATGTATAATTTCTCGTGT
KIAA Alignment based on: KIAA0430 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1350..2159, 2846..3196, 3199..4122
Length: 694 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |