ROUGE

Gene/Protein Characteristic Table for mKIAA0429

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129139
Description :	Metastasis suppressor protein 1.
Clone Name :	mpm06348 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4923 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2189 bp

Genome contig ID gi65543215r_58852399
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GCTTCTGCCTACCTTATAAATAAAGAATCACTAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAGAGTTCTCAGGTCTCCTTCAGATTGTTAGAGCATGGACAGAGCCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0429 DNA sequence

KIAA	Alignment based on:
KIAA0429	DNA sequence

Features of the protein sequence	Description

Coding region: 413..2734
Length: 773 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001381269	2.1e-151	83.0	similar to Meta...	Monodelphis dom...
XP_001151047	8.4e-142	95.2	hypothetical pr...	Pan troglodytes
ABQ59025	3.7e-141	95.0	MTSS1 protein [...	Homo sapiens
CAH93514	4.1e-141	94.6	hypothetical pr...	Pongo abelii
XP_001100263	1.2e-135	93.1	metastasis supp...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003124 745 762 PF02205 Actin-binding WH2

ProfileScan NULL 266 403 PS50324 NULL

IPR000694 626 744 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003124	745	762	PF02205	Actin-binding WH2
ProfileScan	NULL	266	403	PS50324	NULL
IPR000694	626	744	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2189 bp
Genome contig ID	gi65543215r_58852399
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GCTTCTGCCTACCTTATAAATAAAGAATCACTAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAGAGTTCTCAGGTCTCCTTCAGATTGTTAGAGCATGGACAGAGCCT

Gene/Protein Characteristic Table for mKIAA0429

Features of the cloned DNA sequence

Features of the protein sequence