KIAA0429

Product ID	ORK06061
Accession No	AB007889
Description	metastasis suppressor 1
Clone name	hk07754
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4204 bp) Predicted protein sequence (666 aa)
Source	Human adult brain
Rouge ID	mKIAA0429 by Kazusa Mouse cDNA Project
Note	We replaced hh01494, former representative clones for KIAA0429 with hk07754. (2005/08/06)

Length: 4204 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2202 bp
Genome contig ID	gi51511724r_125532212
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTCAGCCTACGTTATAAATAAAGAACCACTAGATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAGTCCTGTATTTCAAGTCTTGTTACAATTCAGTTTGAGGTCTTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	125632212	125672658	11	100.0	Terminal No-hit

Length: 666 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001151047	8.9e-196	99.7	hypothetical pr...	Pan troglodytes
ABQ59025	9.9e-196	99.7	MTSS1 protein [...	Homo sapiens
CAH93514	4.9e-195	99.2	hypothetical pr...	Pongo abelii
XP_001150712	4.8e-191	99.7	metastasis supp...	Pan troglodytes
XP_001497568	4.9e-191	97.3	metastasis supp...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013606	1	173	PF08397	IRSp53/MIM homology domain (IMD)
HMMPfam	IPR003124	638	655	PF02205	Actin-binding WH2
ProfileScan	IPR003124	638	655	PS51082	Actin-binding WH2

Primer_f	ACTGCACAGGGAGAGGTCAAC
Primer_r	CCTTGGGTAGTTCTGCTTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGTAGTGCCTGTGGTTTAGCC
Primer_r	CTATTGTGATTACCTTGCAGC
PCR product length	81 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles