Gene/Protein Characteristic Table for mKIAA0428

Length: 5217 bp

Restriction map

Length of 3'UTR	3020 bp
Genome contig ID	gi65492966f_60079726
PolyA signal sequence (None)	+----*----+----*----+----*----+---- TTTAATTGCTGTAGATCATGTTCTTTCCGCAGGTG
Flanking genome sequence (228130 - 228179)	----+----*----+----*----+----*----+----*----+----* GAAAAAAAAAAAAAAAAAAAAAAAGAAGTTCAAATTTCACAGTTTTAATT

KIAA	Alignment based on:
KIAA0428	DNA sequence, AA sequence, Physical map

Coding region: 1043..2197

Length: 384 aa

Entry Exp ID% Protein Source EDL35373 4.1e-140 100.0 muscleblind-lik... Mus musculus EDM14833 6.9e-140 99.7 rCG50114, isofo... Rattus norvegicus AAK94915 3.4e-139 99.5 muscleblind 41k... Homo sapiens ABQ23439 5.1e-139 99.0 muscleblind-lik... Gallus gallus XP_002188319 7.1e-137 97.2 similar to musc... Taeniopygia guttata

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220470 1.3e-60 70.4 mKIAA4072

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000104	256	270	PR00308	Antifreeze protein
	IPR000104	291	300	PR00308	Antifreeze protein
HMMPfam	IPR000571	17	43	PF00642	Zinc finger
	IPR000571	51	75	PF00642	Zinc finger
	IPR000571	182	208	PF00642	Zinc finger
	IPR000571	218	242	PF00642	Zinc finger
HMMSmart	IPR000571	17	43	SM00356	Zinc finger
	IPR000571	50	75	SM00356	Zinc finger
	IPR000571	181	208	SM00356	Zinc finger
	IPR000571	218	242	SM00356	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-