ROUGE

Gene/Protein Characteristic Table for mKIAA0426

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129138
Description :	Zinc finger protein 96.
Clone Name :	mpm11025 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4406 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2777 bp

Genome contig ID gi65535943f_20742885
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GTATGGATAAAGTAAAATAAATCTTTTTTTAAGTT
Flanking genome sequence
(109469 - 109518)
----+----*----+----*----+----*----+----*----+----*
TCTAGTTTCTCATAATTATGGTAATTGGCTAATCTACAAAGTATGTGCAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0426 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0426	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 103..1629
Length: 508 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH27041	2.7e-203	100.0	Zinc finger and...	Mus musculus
BAC36031	3.3e-202	99.6	unnamed protein...	Mus musculus
Q9Z1D7	5.1e-202	99.4	Zinc finger and...	Mus musculus
EDL84540	5.2e-179	87.5	rCG23053 [Rattu...	Rattus norvegicus
A2T7F4	2.1e-115	67.4	Zinc finger and...	Pongo pygmaeus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173216	5.7e-29	51.3	mKIAA1611
AK220556	1.3e-28	43.4	mKIAA4229
AK220544	2.3e-27	50.0	mKIAA4205
AK173240	8.2e-27	47.1	mKIAA1710
AK172985	1.8e-26	45.2	mKIAA0628

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 304 327 PD000003 Zinc finger

IPR007087 332 355 PD000003 Zinc finger

IPR007087 416 438 PD000003 Zinc finger

FPrintScan IPR007086 461 474 PR00048 Zinc finger

IPR007086 477 486 PR00048 Zinc finger

HMMPfam IPR003309 47 142 PF02023 Transcriptional regulator SCAN

IPR007087 276 298 PF00096 Zinc finger

IPR007087 304 326 PF00096 Zinc finger

IPR007087 332 354 PF00096 Zinc finger

IPR007087 360 382 PF00096 Zinc finger

IPR007087 388 410 PF00096 Zinc finger

IPR007087 416 438 PF00096 Zinc finger

IPR007087 462 484 PF00096 Zinc finger

HMMSmart IPR003309 49 161 SM00431 Transcriptional regulator SCAN

IPR007087 276 298 SM00355 Zinc finger

IPR007087 304 326 SM00355 Zinc finger

IPR007087 332 354 SM00355 Zinc finger

IPR007087 360 382 SM00355 Zinc finger

IPR007087 388 410 SM00355 Zinc finger

IPR007087 416 438 SM00355 Zinc finger

IPR007087 462 484 SM00355 Zinc finger

ProfileScan IPR003309 53 135 PS50804 Transcriptional regulator SCAN

IPR007087 276 303 PS50157 Zinc finger

IPR007087 304 331 PS50157 Zinc finger

IPR007087 332 359 PS50157 Zinc finger

IPR007087 360 387 PS50157 Zinc finger

IPR007087 388 415 PS50157 Zinc finger

IPR007087 416 443 PS50157 Zinc finger

IPR007087 462 489 PS50157 Zinc finger

IPR007087 490 508 PS50157 Zinc finger

ScanRegExp IPR007087 278 298 PS00028 Zinc finger

IPR007087 306 326 PS00028 Zinc finger

IPR007087 334 354 PS00028 Zinc finger

IPR007087 362 382 PS00028 Zinc finger

IPR007087 390 410 PS00028 Zinc finger

IPR007087 418 439 PS00028 Zinc finger

IPR007087 464 484 PS00028 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	304	327	PD000003	Zinc finger
IPR007087	332	355	PD000003	Zinc finger
IPR007087	416	438	PD000003	Zinc finger
FPrintScan	IPR007086	461	474	PR00048	Zinc finger
IPR007086	477	486	PR00048	Zinc finger
HMMPfam	IPR003309	47	142	PF02023	Transcriptional regulator SCAN
IPR007087	276	298	PF00096	Zinc finger
IPR007087	304	326	PF00096	Zinc finger
IPR007087	332	354	PF00096	Zinc finger
IPR007087	360	382	PF00096	Zinc finger
IPR007087	388	410	PF00096	Zinc finger
IPR007087	416	438	PF00096	Zinc finger
IPR007087	462	484	PF00096	Zinc finger
HMMSmart	IPR003309	49	161	SM00431	Transcriptional regulator SCAN
IPR007087	276	298	SM00355	Zinc finger
IPR007087	304	326	SM00355	Zinc finger
IPR007087	332	354	SM00355	Zinc finger
IPR007087	360	382	SM00355	Zinc finger
IPR007087	388	410	SM00355	Zinc finger
IPR007087	416	438	SM00355	Zinc finger
IPR007087	462	484	SM00355	Zinc finger
ProfileScan	IPR003309	53	135	PS50804	Transcriptional regulator SCAN
IPR007087	276	303	PS50157	Zinc finger
IPR007087	304	331	PS50157	Zinc finger
IPR007087	332	359	PS50157	Zinc finger
IPR007087	360	387	PS50157	Zinc finger
IPR007087	388	415	PS50157	Zinc finger
IPR007087	416	443	PS50157	Zinc finger
IPR007087	462	489	PS50157	Zinc finger
IPR007087	490	508	PS50157	Zinc finger
ScanRegExp	IPR007087	278	298	PS00028	Zinc finger
IPR007087	306	326	PS00028	Zinc finger
IPR007087	334	354	PS00028	Zinc finger
IPR007087	362	382	PS00028	Zinc finger
IPR007087	390	410	PS00028	Zinc finger
IPR007087	418	439	PS00028	Zinc finger
IPR007087	464	484	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2777 bp
Genome contig ID	gi65535943f_20742885
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTATGGATAAAGTAAAATAAATCTTTTTTTAAGTT
Flanking genome sequence (109469 - 109518)	----+--------+--------+--------+--------+----* TCTAGTTTCTCATAATTATGGTAATTGGCTAATCTACAAAGTATGTGCAT

Gene/Protein Characteristic Table for mKIAA0426

Features of the cloned DNA sequence

Features of the protein sequence