ROUGE

Gene/Protein Characteristic Table for mKIAA0425

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129137
Description :
Clone Name :	mpm06367 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5456 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 482 bp

Genome contig ID gi65493515r_125790742
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CCTGGAAGATCCAATAAAAATACTCAAGTTTTTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGATAGTGGTCTGGATTGATTTTCACTGCCAACCTACTTATGTGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0425 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0425	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 238..4974
Length: 1578 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
A2A791	99.9	Zinc finger MYM...	Mus musculus
EDL30272	99.9	mCG120696 [Mus ...	Mus musculus
EDL80469	97.5	zinc finger, MY...	Rattus norvegicus
XP_001058950	97.4	similar to zinc...	Rattus norvegicus
XP_001101903	94.0	similar to zinc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122268	2e-23	39.4	mKIAA0385

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010507 391 431 PF06467 Zinc finger

IPR010507 443 486 PF06467 Zinc finger

IPR010507 493 528 PF06467 Zinc finger

IPR010507 539 573 PF06467 Zinc finger

IPR010507 583 621 PF06467 Zinc finger

IPR010507 629 660 PF06467 Zinc finger

IPR010507 737 771 PF06467 Zinc finger

IPR010507 778 817 PF06467 Zinc finger

IPR010507 824 858 PF06467 Zinc finger

ScanRegExp IPR001545 518 524 PS00261 Gonadotropin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010507	391	431	PF06467	Zinc finger
IPR010507	443	486	PF06467	Zinc finger
IPR010507	493	528	PF06467	Zinc finger
IPR010507	539	573	PF06467	Zinc finger
IPR010507	583	621	PF06467	Zinc finger
IPR010507	629	660	PF06467	Zinc finger
IPR010507	737	771	PF06467	Zinc finger
IPR010507	778	817	PF06467	Zinc finger
IPR010507	824	858	PF06467	Zinc finger
ScanRegExp	IPR001545	518	524	PS00261	Gonadotropin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	482 bp
Genome contig ID	gi65493515r_125790742
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CCTGGAAGATCCAATAAAAATACTCAAGTTTTTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAGATAGTGGTCTGGATTGATTTTCACTGCCAACCTACTTATGTGA

Gene/Protein Characteristic Table for mKIAA0425

Features of the cloned DNA sequence

Features of the protein sequence