ROUGE

Gene/Protein Characteristic Table for mKIAA0421

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129136
Description :
Clone Name :	mbg06889 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6284 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4232 bp

Genome contig ID gi65511124r_111907205
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AAAAAAATAAAAATAAAGGTTCAAGTCTTAAAAAG
Flanking genome sequence
(99965 - 99916)
----+----*----+----*----+----*----+----*----+----*
ATAACAGTATCTAAGCTCTGAATTTATTGAAGTAGATCCCAGAAAGTTTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0421 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0421	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2052
Length: 683 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL17124	100.0	RIKEN cDNA 2610...	Mus musculus
EDL17123	100.0	RIKEN cDNA 2610...	Mus musculus
NP_001026984	100.0	PI-3-kinase-rel...	Mus musculus
Q8BKX6	99.9	Serine/threonin...	Mus musculus
XP_001078729	99.4	similar to PI-3...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003152 651 683 PF02260 PIK-related kinase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003152	651	683	PF02260	PIK-related kinase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4232 bp
Genome contig ID	gi65511124r_111907205
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AAAAAAATAAAAATAAAGGTTCAAGTCTTAAAAAG
Flanking genome sequence (99965 - 99916)	----+--------+--------+--------+--------+----* ATAACAGTATCTAAGCTCTGAATTTATTGAAGTAGATCCCAGAAAGTTTG

Gene/Protein Characteristic Table for mKIAA0421

Features of the cloned DNA sequence

Features of the protein sequence