ROUGE

Gene/Protein Characteristic Table for mKIAA0417

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093239
Description :	Heat shock 70 kDa protein 12A.
Clone Name :	mbg00568 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5675 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3608 bp

Genome contig ID gi65553144r_58295309
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTCACAGATTCTAATAAAGTAAACCTCTCAATTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACACGGCCTAGAATCGTTTTTCTCATTTGGGGTGTAGGTGGATTTGTAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0417 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0417	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 28..2067
Length: 679 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL01811	99.9	heat shock prot...	Mus musculus
Q8K0U4	99.7	Heat shock 70 k...	Mus musculus
EDL94544	98.5	heat shock 70kD...	Rattus norvegicus
O43301	96.3	Heat shock 70 k...	Homo sapiens
XP_544034	96.3	similar to Heat...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3608 bp
Genome contig ID	gi65553144r_58295309
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTCACAGATTCTAATAAAGTAAACCTCTCAATTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACACGGCCTAGAATCGTTTTTCTCATTTGGGGTGTAGGTGGATTTGTAGG

Gene/Protein Characteristic Table for mKIAA0417

Features of the cloned DNA sequence

Features of the protein sequence