KIAA0417

Product ID	ORK00071
Accession No	AB007877
Description	heat shock 70kDa protein 12A
Clone name	hh00790
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5721 bp) Predicted protein sequence (710 aa)
HaloTag ORF Clone	FHC00071
Flexi ORF Clone	FXC00071
Source	Human adult brain
Rouge ID	mKIAA0417 by Kazusa Mouse cDNA Project

Length: 5721 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3588 bp
Genome contig ID	gi89161187r_118320694
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TCACAGACGCCTAATAAAGCAAAACTCTGAATCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTGGCCCAGATTTTTTTTCCCCCCATCCTGGGTTTGCAAACTGCATGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	118420694	118492075	12	100.0	Perfect prediction

Length: 710 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O43301	100.0	Heat shock 70 k...	Homo sapiens
XP_529348	99.8	heat shock prot...	Pan troglodytes
XP_001095628	99.1	heat shock prot...	Macaca mulatta
EDL94544	96.7	heat shock 70kD...	Rattus norvegicus
EDL01811	96.5	heat shock prot...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	AGTGAATGAGACCCCAGTAGC
Primer_r	TGTATGCTGGGAAACGGCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 10

Experimental conditions

Panel name	GeneBridge 4
Primer_f	AGTGAATGAGACCCCAGTAGC
Primer_r	TGTATGCTGGGAAACGGCTTG
PCR product length	185 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles