ROUGE

Gene/Protein Characteristic Table for mKIAA0383

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129129
Description :	MYST histone acetyltransferase monocytic leukemia 4. histone acetyltransferase. MYST histone acetyltransferase (monocytic leukemia) 4. monocytic leukemia.
Clone Name :	mbg07072 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4839 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4202 bp

Genome contig ID gi65540054f_19781687
PolyA signal sequence
(AAGAAA,-7)
+----*----+----*----+----*----+----
GAGAAAACTTGTCTCAAAAAAAGAAAGAAAGAAAG
Flanking genome sequence
(104839 - 104888)
----+----*----+----*----+----*----+----*----+----*
AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAGAAAAGAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0383 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0383	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..637
Length: 211 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC33305	9.9e-83	100.0	unnamed protein...	Mus musculus
BAC38771	3.1e-61	100.0	unnamed protein...	Mus musculus
BAE22542	3.5e-61	100.0	unnamed protein...	Mus musculus
AAH95974	7.3e-61	100.0	Myst4 protein [...	Mus musculus
BAC32253	8e-61	100.0	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005818 63 129 PF00538 Histone H1/H5

HMMSmart IPR005818 46 123 SM00526 Histone H1/H5

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005818	63	129	PF00538	Histone H1/H5
HMMSmart	IPR005818	46	123	SM00526	Histone H1/H5

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4202 bp
Genome contig ID	gi65540054f_19781687
PolyA signal sequence (AAGAAA,-7)	+--------+--------+----*----+---- GAGAAAACTTGTCTCAAAAAAAGAAAGAAAGAAAG
Flanking genome sequence (104839 - 104888)	----+--------+--------+--------+--------+----* AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAGAAAAGAAA

Gene/Protein Characteristic Table for mKIAA0383

Features of the cloned DNA sequence

Features of the protein sequence