ROUGE |
Gene/Protein Characteristic Table for mKIAA0376 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AB093236 |
---|---|
mbg00975 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6262 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2492 bp Genome contig ID gi65524842f_75214131 PolyA signal sequence
(AGTAAA,-19) +----*----+----*----+----*----+----
TTTGTCATTTTGTTCTAGTAAATACTCTTGAATGTFlanking genome sequence
(199985 - 200034) ----+----*----+----*----+----*----+----*----+----*
AATAAACTGTCATGCGTCGATTTCCTAGTTTGTTCTCCCTCCCTGCTGTC
KIAA Alignment based on: KIAA0376 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 363..3770
Length: 1135 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001715 | 1031 | 1134 | PF00307 | Calponin-like actin-binding |
HMMSmart | IPR001715 | 1031 | 1129 | SM00033 | Calponin-like actin-binding |
ProfileScan | IPR001715 | 1029 | 1131 | PS50021 | Calponin-like actin-binding |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |