ROUGE

Gene/Protein Characteristic Table for mKIAA0372

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129128
Description :
Clone Name :	mfk00395 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4333 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1905 bp

Genome contig ID gi65535943f_72092055
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TCTTGTTTAAATGCATTAAATTTACATAACATGGG
Flanking genome sequence
(155373 - 155422)
----+----*----+----*----+----*----+----*----+----*
AACCTGGGTTACATTTGTGAAACTTGTGTTGAATGGAAAGAACCACTCCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0372 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0372	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2428
Length: 808 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL37116	100.0	mCG116369 [Mus ...	Mus musculus
AAI56422	99.3	Tetratricopepti...	synthetic construct
XP_001059136	92.1	similar to CG87...	Rattus norvegicus
XP_001918367	85.4	similar to Tetr...	Equus caballus
XP_536294	85.4	similar to CG87...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001440 106 139 PF00515 TPR repeat

NULL 106 139 PF07719 NULL

IPR001440 225 258 PF00515 TPR repeat

IPR001440 644 677 PF00515 TPR repeat

HMMSmart IPR001440 106 139 SM00028 TPR repeat

IPR001440 225 258 SM00028 TPR repeat

IPR001440 296 329 SM00028 TPR repeat

IPR001440 333 366 SM00028 TPR repeat

IPR001440 644 677 SM00028 TPR repeat

ProfileScan IPR001440 35 139 PS50293 TPR repeat

IPR001440 106 139 PS50005 TPR repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	106	139	PF00515	TPR repeat
NULL	106	139	PF07719	NULL
IPR001440	225	258	PF00515	TPR repeat
IPR001440	644	677	PF00515	TPR repeat
HMMSmart	IPR001440	106	139	SM00028	TPR repeat
IPR001440	225	258	SM00028	TPR repeat
IPR001440	296	329	SM00028	TPR repeat
IPR001440	333	366	SM00028	TPR repeat
IPR001440	644	677	SM00028	TPR repeat
ProfileScan	IPR001440	35	139	PS50293	TPR repeat
IPR001440	106	139	PS50005	TPR repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1905 bp
Genome contig ID	gi65535943f_72092055
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TCTTGTTTAAATGCATTAAATTTACATAACATGGG
Flanking genome sequence (155373 - 155422)	----+--------+--------+--------+--------+----* AACCTGGGTTACATTTGTGAAACTTGTGTTGAATGGAAAGAACCACTCCT

Gene/Protein Characteristic Table for mKIAA0372

Features of the cloned DNA sequence

Features of the protein sequence