ROUGE

Gene/Protein Characteristic Table for mKIAA0365

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122260
Description :	arginine/serine-rich 14 splicing factor.
Clone Name :	mbg06816 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 7253 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 6139 bp

Genome contig ID gi65515060f_69296560
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TACAGTGTACTCATATACACAAAATCAACCAATCC
Flanking genome sequence
(114688 - 114737)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGGAGCTCTGTCACCACTAGGCTGTAGTAGAAGCTCAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0365 DNA sequence

KIAA	Alignment based on:
KIAA0365	DNA sequence

Features of the protein sequence	Description

Coding region: 2..1111
Length: 370 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC31218	6.4e-122	98.9	unnamed protein...	Mus musculus
AAN77118	6.4e-122	98.9	arginine/serine...	Mus musculus
Q8CH09	6.4e-122	98.9	Putative splici...	Mus musculus
EDL28804	6.5e-122	98.9	splicing factor...	Mus musculus
AAH42763	1.2e-121	99.2	Sfrs14 protein ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000061 170 213 PF01805 SWAP/Surp

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000061	170	213	PF01805	SWAP/Surp

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	6139 bp
Genome contig ID	gi65515060f_69296560
PolyA signal sequence (None)	+--------+--------+----*----+---- TACAGTGTACTCATATACACAAAATCAACCAATCC
Flanking genome sequence (114688 - 114737)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGGAGCTCTGTCACCACTAGGCTGTAGTAGAAGCTCAG

Gene/Protein Characteristic Table for mKIAA0365

Features of the cloned DNA sequence

Features of the protein sequence