| ROUGE |
Gene/Protein Characteristic Table for mKIAA0365 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK122260 |
|---|---|
| arginine/serine-rich 14 splicing factor. | |
| mbg06816 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 7253 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 6139 bp Genome contig ID gi65515060f_69296560 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TACAGTGTACTCATATACACAAAATCAACCAATCCFlanking genome sequence
(114688 - 114737) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGGAGCTCTGTCACCACTAGGCTGTAGTAGAAGCTCAG
KIAA Alignment based on: KIAA0365 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2..1111
Length: 370 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |