ROUGE

Gene/Protein Characteristic Table for mKIAA0356

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC053079
Description :	pleckstrin homology domain containing, family M (with RUN domain) member 1.
Clone Name :	mbg18666 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4456 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1792 bp

Genome contig ID gi65527427r_103086180
PolyA signal sequence
(AGTAAA,-24)
+----*----+----*----+----*----+----
AGTGATTTTGCAGTAAAGAGCTGGCCTTTCTAAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTCTTGTTTCTGAATCTCAATCATTTGGCTCTGGGGAAACACTACCTGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0356 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0356	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2664
Length: 887 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7TSI1	0	100.0	Pleckstrin homo...	Mus musculus
BAE32773	0	99.9	unnamed protein...	Mus musculus
Q5PQS0	6.4e-184	92.1	Pleckstrin homo...	Rattus norvegicus
EDL34189	5.2e-181	100.0	mCG140726 [Mus ...	Mus musculus
CAB91652	6.4e-172	80.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122221	1.8e-11	32.9	mKIAA0226

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 365 455 PF00169 Pleckstrin-like

HMMSmart IPR001849 365 457 SM00233 Pleckstrin-like

IPR001849 515 610 SM00233 Pleckstrin-like

IPR002219 818 871 SM00109 Protein kinase C

ProfileScan IPR001849 364 455 PS50003 Pleckstrin-like

IPR001849 514 608 PS50003 Pleckstrin-like

IPR002219 817 871 PS50081 Protein kinase C

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	365	455	PF00169	Pleckstrin-like
HMMSmart	IPR001849	365	457	SM00233	Pleckstrin-like
IPR001849	515	610	SM00233	Pleckstrin-like
IPR002219	818	871	SM00109	Protein kinase C
ProfileScan	IPR001849	364	455	PS50003	Pleckstrin-like
IPR001849	514	608	PS50003	Pleckstrin-like
IPR002219	817	871	PS50081	Protein kinase C

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1792 bp
Genome contig ID	gi65527427r_103086180
PolyA signal sequence (AGTAAA,-24)	+--------+--------+----*----+---- AGTGATTTTGCAGTAAAGAGCTGGCCTTTCTAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCTTGTTTCTGAATCTCAATCATTTGGCTCTGGGGAAACACTACCTGG

Gene/Protein Characteristic Table for mKIAA0356

Features of the cloned DNA sequence

Features of the protein sequence